| Sequence ID | >W1711391159 |
| Genome ID | MEKJ01000064 |
| Phylum/Class | Acidobacteriota |
| Species | Acidobacteria bacterium RBG_16_64_8 [MEKJ] |
| Start position on genome | 10263 |
| End posion on genome | 10190 |
| Amino Acid | Gln |
| Anticodon | CTG |
| Upstream region at tRNA start position |
agttttccgc |
| tRNA gene sequence |
TGGGGGATCGTCTAGTGGTAGGACGACGGGCTCTGGACCCGTTAGCGGGGGTTCGAATCC |
| Downstream region at tRNA end position |
ctcggaattc |
| Secondary structure (Cloverleaf model) | >W1711391159 Gln CTG
c GCCA ctcggaattc
T - A
G - C
G - C
G - C
G - C
G - C
A - T T A
T C C T C C A
G A C | | + | | G
T T C T G G G G G G C
G + | | | T T
G G G A C
T A G TAGC
A - T
C - G
G - C
G - C
G - C
C A
T G
C T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |