Sequence ID | >W1711391275 |
Genome ID | MELI01000005 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Candidatus Aquicultor primus GWC2_53_9 [MELI] |
Start position on genome | 7358 |
End posion on genome | 7434 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcgataacgg |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCCGGTAGCTCGTCGGGCTCATAACCCGAAGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
gcgagttctt |
Secondary structure (Cloverleaf model) | >W1711391275 Met CAT g ACCA gcgagttctt C T G - C C - G G - C G - C G - C G - C T A T T G T C C A T G A G | | | | | A C C G A G A C A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |