Sequence ID | >W131170250 |
Genome ID | ARFJ01000022 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Bradyrhizobium japonicum USDA 124 [ARFJ] |
Start position on genome | 38922 |
End posion on genome | 38830 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ggctcgcacc |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGCTGAAGGCAACGCTTTGCTAAAGCGTCATACGGTCTCAAGCT |
Downstream region at tRNA end position |
cccaacagca |
Secondary structure (Cloverleaf model) | >W131170250 Ser GCT c GCCA cccaacagca G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C T G A A CATACGGTCTCAAGCTGTATC A - T C - G G - C C - G T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |