Sequence ID | >W1711404523 |
Genome ID | MFYM01000022 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Candidatus Peribacteria bacterium RIFOXYC1_FULL_54_13 [MFYM] |
Start position on genome | 211110 |
End posion on genome | 211186 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ttcacatcac |
tRNA gene sequence |
GGACGATTAGCTCAGCTGGTTAGAGCGTACGGTTCACATCCGTAAGGTCACTGGTTCGAA |
Downstream region at tRNA end position |
ttcgactcgt |
Secondary structure (Cloverleaf model) | >W1711404523 Val CAC c ACCA ttcgactcgt G - C G - C A - T C - G G - C A - T T - A T A T T G A C C A C G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C T T A G AGGTC T - A A - T C - G G - C G - C T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |