Sequence ID | >W1711410440 |
Genome ID | MGPZ01000061 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Deltaproteobacteria bacterium GWD2_55_8 [MGPZ] |
Start position on genome | 5256 |
End posion on genome | 5178 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aaatcaccgc |
tRNA gene sequence |
GGGGTCGTGGTGTAGCCTGGTTTAACACGTCGCCCTGTCAAGGCGAAGACCGCGGGTTCG |
Downstream region at tRNA end position |
aattttcttc |
Secondary structure (Cloverleaf model) | >W1711410440 Asp GTC c GCCA aattttcttc G - C G - C G - C G - C T - A C - G G - C T A T T G C C C A C C G A G + | | | | G T T G T G G C G G G C G | | | | T T G A C A C T T T A G AGACC T - A C - G G - C C - G C - G C A T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |