Sequence ID | >W1711410792 |
Genome ID | MGQN01000031 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Deltaproteobacteria bacterium RBG_16_44_11 [MGQN] |
Start position on genome | 12015 |
End posion on genome | 12089 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttgagcatat |
tRNA gene sequence |
TGGGGCGTCGTCAAGCGGTAAGACACAGGATTTTGGTTCCTGCATTCGGAGGTTCGAATC |
Downstream region at tRNA end position |
taaagaggat |
Secondary structure (Cloverleaf model) | >W1711410792 Gln TTG t GCCA taaagaggat T - A G - C G - C G - C G - C C - G G - C T A T C C T C C A G A C | | | | | G C A C T G G G A G G C G | | | T T G A G A C T A A CATTC C - G A - T G - C G - C A - T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |