Sequence ID | >W1711411401 |
Genome ID | MGTB01000071 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Deltaproteobacteria bacterium RIFOXYD12_FULL_53_23 [MGTB] |
Start position on genome | 2586 |
End posion on genome | 2510 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cccttatatg |
tRNA gene sequence |
GTGAGCGTAGCTCAGCTGGTGGTAGCACCGGGTTGTGGCCTCGGAGGTCGTGGGTTCAAG |
Downstream region at tRNA end position |
ttaaagaatc |
Secondary structure (Cloverleaf model) | >W1711411401 His GTG g CCCA ttaaagaatc G - C T - A G - C A - T G - C C - G G - C T G T T A C C C A C G A A + | | | | A T C T C G G T G G G C G | | | T T G T A G C T G G A AGGTC C - G C - G G - C G + T G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |