Sequence ID | >W1711411608 |
Genome ID | MGTI01000020 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfobacterales bacterium GWB2_56_26 [MGTI] |
Start position on genome | 39036 |
End posion on genome | 39127 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
aaacagatgc |
tRNA gene sequence |
GGAGAGGTGACCGAGAGGCCGATGGTGCTCGCCTGCTAAGCGAGTGTGGGGGTAAAACCC |
Downstream region at tRNA end position |
aattaaatgc |
Secondary structure (Cloverleaf model) | >W1711411608 Ser GCT c GCCA aattaaatgc G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A A G A G | | | | | G G G C C A G A G G G C G + | | | T T C T G G T C G A G TGTGGGGGTAAAACCCCACC C - G T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |