Sequence ID | >W1711411619 |
Genome ID | MGTI01000057 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfobacterales bacterium GWB2_56_26 [MGTI] |
Start position on genome | 6821 |
End posion on genome | 6897 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aacactctct |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTAGGTCACTGGTTCGAA |
Downstream region at tRNA end position |
ataaatagca |
Secondary structure (Cloverleaf model) | >W1711411619 Arg TCT t ACCA ataaatagca G + T C - G G - C C - G C - G C - G G - C T A T T G A C C A C G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C A T A A AGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |