Sequence ID | >W1711412705 |
Genome ID | MGUY01000093 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Elusimicrobia bacterium RIFOXYA1_FULL_47_7 [MGUY] |
Start position on genome | 5438 |
End posion on genome | 5353 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ctatattcaT |
tRNA gene sequence |
GCCGAGGTGGTGGAACTGGCAGACACGCTAGCTTCAGGAGCTAGTGGGCGCAGGCTCATA |
Downstream region at tRNA end position |
ttccaaatca |
Secondary structure (Cloverleaf model) | >W1711412705 Leu CAG T AGtt ttccaaatca G - C C - G C - G G - C A - T G - C G - C T C T T C C C C A C A A G | | | | | A T G G T G A G G G G C G | | | T T G A C A C C A G G TGGGCGCAGGCTCAT C - G T - A A - T G - C C - G T A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |