Sequence ID | >W1711412836 |
Genome ID | MGVC01000013 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Elusimicrobia bacterium RIFOXYA2_FULL_39_19 [MGVC] |
Start position on genome | 163185 |
End posion on genome | 163112 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ttgaattagc |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGTTAGAGTACTACGTTGACATCGTAGGGGTCACAGGTTCGAG |
Downstream region at tRNA end position |
taatcatttg |
Secondary structure (Cloverleaf model) | >W1711412836 Val GAC c Attt taatcatttg G - C G - C G - C C - G G - C A - T T - A T G T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | + T T G G A G T T T A A GGGTC C - G T - A A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |