Sequence ID | >W1711412837 |
Genome ID | MGVC01000014 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Elusimicrobia bacterium RIFOXYA2_FULL_39_19 [MGVC] |
Start position on genome | 51096 |
End posion on genome | 51180 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
actgctttaT |
tRNA gene sequence |
GGGCGCGTGGCGGAATGGCAGACGCGTTAGGTTCAGGACCTAATAATCTCACGATTGTGG |
Downstream region at tRNA end position |
tcttacctga |
Secondary structure (Cloverleaf model) | >W1711412837 Leu CAG T AGtt tcttacctga G - C G - C G - C C - G G - C C - G G - C T C T T C T C C A T A A G + | | | | A G G G C G G G A G G C G | | | T T C A C G C A G G TAATCTCACGATTGT T - A T - A A - T G - C G - C T A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |