Sequence ID | >W1711412907 |
Genome ID | MGVE01000006 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Elusimicrobia bacterium RIFOXYA2_FULL_47_53 [MGVE] |
Start position on genome | 283930 |
End posion on genome | 284006 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
actttcagct |
tRNA gene sequence |
GCCGCCATCGTCTAGGGGTTTAGGACATCGCCCTCTCAAGGCGGAGATCGGGGGTTCAAA |
Downstream region at tRNA end position |
attttaccct |
Secondary structure (Cloverleaf model) | >W1711412907 Glu CTC t GCCA attttaccct G - C C - G C - G G - C C - G C - G A - T T A T C C C C C A G G A C | | | | | A G T C T G G G G G G C G + | | | T T T G G A C T T A A AGATC T + G C - G G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |