Sequence ID | >W1711412949 |
Genome ID | MGVF01000026 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Elusimicrobia bacterium RIFOXYA2_FULL_50_26 [MGVF] |
Start position on genome | 85 |
End posion on genome | -1 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aataactatT |
tRNA gene sequence |
GCCGAGGTGGTGGAATTGGCAGACACGCAGGCCTCAGGAGTCTGTCCCCGCAAGGGGGTG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >W1711412949 Leu CAG T ANNn nnnnnnnnnn G - C C - G C - G G - C A - T G - C G - C T C T C G C T C A T A A G | | | | | A T G G T G G C G A G C G | | | T T G A C A C C A G G TCCCCGCAAGGGGGT C - G A - T G - C G + T C - G C A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |