Sequence ID | >W1711413088 |
Genome ID | MGVK01000001 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Elusimicrobia bacterium RIFOXYB12_FULL_50_12 [MGVK] |
Start position on genome | 201237 |
End posion on genome | 201166 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tgagacttgt |
tRNA gene sequence |
GGGGGCATAAGCTAACGGTAAACTTCCGGTCTCCAAAACCGGTCTTGAGGGTTCAAATCC |
Downstream region at tRNA end position |
gagctttagt |
Secondary structure (Cloverleaf model) | >W1711413088 Trp CCA t GCtt gagctttagt G - C G - C G - C G - C G - C C - G A - T T A T C T T C C A A A A | | + | | A C T C G A G A G G G C G | | | T T G A A C T T A T TCTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |