Sequence ID | >W1711413247 |
Genome ID | MGVO01000005 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Elusimicrobia bacterium RIFOXYB2_FULL_50_12 [MGVO] |
Start position on genome | 3728 |
End posion on genome | 3651 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cgctgttcaT |
tRNA gene sequence |
GGGGATGTGGTGTAGCCTGGTCTAACACGCTGCCCTGTCAAGGCAGAGACCGCGGGTTCA |
Downstream region at tRNA end position |
atttttacgg |
Secondary structure (Cloverleaf model) | >W1711413247 Asp GTC T GTat atttttacgg G - C G - C G - C G - C A - T T - A G - C T A T T G C C C A C C G A G + | | | | A T T G T G G C G G G C G | | | | T T G A C A C T C T A G AGACC C - G T - A G - C C - G C - G C A T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |