Sequence ID | >W1711413258 |
Genome ID | MGVO01000052 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Elusimicrobia bacterium RIFOXYB2_FULL_50_12 [MGVO] |
Start position on genome | 40940 |
End posion on genome | 41014 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ttctgctgtt |
tRNA gene sequence |
GCGCCCATAGCTCAACTGGATAGAGCGTTTGACTACGAATCAAAAGGTTAGAGGTTCAAG |
Downstream region at tRNA end position |
tataaataag |
Secondary structure (Cloverleaf model) | >W1711413258 Arg ACG t GCtt tataaataag G - C C - G G - C C - G C - G C - G A - T T G T T C T C C A C A A A | | | | | A T C T C G A G A G G C G | | | | T T G G A G C A T A G AGGTT T - A T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |