Sequence ID | >W1711413283 |
Genome ID | MGVP01000220 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Elusimicrobia bacterium RIFOXYB2_FULL_62_6 [MGVP] |
Start position on genome | 6487 |
End posion on genome | 6414 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
aacagatttc |
tRNA gene sequence |
GGGCGTGTAGCTCAGCTGGGAGAGCGCCTGCATGGCATGCAGGAGGTCAGGGGTTCGAGC |
Downstream region at tRNA end position |
gctttaaaaa |
Secondary structure (Cloverleaf model) | >W1711413283 Ala GGC c ACtc gctttaaaaa G - C G - C G + T C - G G - C T - A G - C C G T T C C C C A C G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |