Sequence ID | >W1711414281 |
Genome ID | MGZH01000097 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Geobacteraceae bacterium GWB2_52_12 [MGZH] |
Start position on genome | 9622 |
End posion on genome | 9547 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tatcttcttc |
tRNA gene sequence |
GAGCCGCTAGCTCAGTCGGTAGAGCACCTGACTTTTAATCAGGTGGTCGTTGGTTCGACC |
Downstream region at tRNA end position |
tgtccccttc |
Secondary structure (Cloverleaf model) | >W1711414281 Lys TTT c ACCA tgtccccttc G - C A - T G - C C - G C - G G - C C - G C C T C A A C C A T G A A | | | | | G C C T C G G T T G G C G | | | | T T G G A G C T A A TGGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |