Sequence ID | >W1711414472 |
Genome ID | MGZM01000244 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Geobacteraceae bacterium GWF2_54_21 [MGZM] |
Start position on genome | 397 |
End posion on genome | 473 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tcgcatgtac |
tRNA gene sequence |
AGGCCAGTAGCTCTAACGGCTAGAGCGCCGGTCTCCAAAACCGGATGTTGGGGGTTCGAA |
Downstream region at tRNA end position |
taatcataag |
Secondary structure (Cloverleaf model) | >W1711414472 Trp CCA c GCCA taatcataag A - T G - C G - C C - G C - G A - T G - C T A T C T C C C A A A T A | + | | | G C C T C G G G G G G C G | | | | T T G G A G C C T A G ATGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |