Sequence ID | >W1711416119 |
Genome ID | MHBN01000244 |
Search identical group | |
Phylum/Class | Lentisphaerota |
Species | Lentisphaerae bacterium RIFOXYA12_FULL_60_10 [MHBN] |
Start position on genome | 18776 |
End posion on genome | 18700 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cttattcgat |
tRNA gene sequence |
TGCGGGGTGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGTTGGTTCAAA |
Downstream region at tRNA end position |
atttgagggc |
Secondary structure (Cloverleaf model) | >W1711416119 Met CAT t ACCA atttgagggc T T G - C C - G G - C G - C G - C G - C T A T C A A C C A C G A G | | | | | A C C G A G G T T G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |