Sequence ID | >W1711421390 |
Genome ID | MHYK01000106 |
Search identical group | |
Phylum/Class | Planctomycetota |
Species | Planctomycetes bacterium RBG_16_55_9 [MHYK] |
Start position on genome | 29167 |
End posion on genome | 29093 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gaaagattgT |
tRNA gene sequence |
TCCCCGATAGCTCAATCGGTAGAGCGAGCGGCTGTTAACCGCTAGGTTGTAGGTTCGAGT |
Downstream region at tRNA end position |
ggaaatcacg |
Secondary structure (Cloverleaf model) | >W1711421390 Asn GTT T GTtt ggaaatcacg T - A C - G C - G C - G C - G G - C A - T T G T C A T C C A T A A A | | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A G AGGTT A - T G - C C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |