Sequence ID | >W131087288 |
Genome ID | AOCK01000012 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Paeniglutamicibacter gangotriensis Lz1y [AOCK] |
Start position on genome | 135770 |
End posion on genome | 135845 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ctgcactaat |
tRNA gene sequence |
CGGGGTGTAGCTCAGCTTGGCTAGAGCGCGCGCTTTGGGAGCGTGAGGTCGCAGGTTCGA |
Downstream region at tRNA end position |
tgtattcaac |
Secondary structure (Cloverleaf model) | >W131087288 Pro TGG t ACtc tgtattcaac C - G G - C G - C G - C G - C T - A G - C T A T T G T C C A T C G A A + | | | | G T C T C G G C A G G C G | | | | T T G G A G C C T A G AGGTC C - G G + T C - G G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |