Sequence ID | >W1711423198 |
Genome ID | MICN01000001 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Syntrophus sp. GWC2_56_31 [MICN] |
Start position on genome | 9400 |
End posion on genome | 9474 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
gttccgccac |
tRNA gene sequence |
GGTCCCATCGTCTAGTGGTTAGGACGCTGGCCTCTCACGCCGGAAACCGGGGTTCAAGCC |
Downstream region at tRNA end position |
aaggaaatac |
Secondary structure (Cloverleaf model) | >W1711423198 Glu CTC c ACCA aaggaaatac G + T G - C T - A C - G C - G C - G A - T C G T G C C C C A T G A C | | | | | A G T C T G C G G G G C G + | | | T T T G G A C T A G AAAC C - G T + G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |