Sequence ID | >W131155754 |
Genome ID | AQOV01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Methylomonas sp. MK1 [AQOV] |
Start position on genome | 1999847 |
End posion on genome | 1999764 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
caattattta |
tRNA gene sequence |
GCGAGCGTGGCGAAATTGGTAGACGCGCTGGATTTAGGTTCCAGTGGTAACCCCGTGGGA |
Downstream region at tRNA end position |
tatcctgcgt |
Secondary structure (Cloverleaf model) | >W131155754 Leu TAG a ACCA tatcctgcgt G - C C - G G - C A - T G - C C - G G - C T G T C C C T C A T A A G | | | | | G T A G C G G G G A G C G | | | T T G A C G C T A G G TGGTAACCCCGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |