Sequence ID | >W131217986 |
Genome ID | ATXH01000002 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Thermodesulfatator atlanticus DSM 21156 [ATXH] |
Start position on genome | 128984 |
End posion on genome | 128891 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tctgtcctaa |
tRNA gene sequence |
GGAGGGGTGCCCGAGCGGCCGAAGGGGCACGACTGGAAATCGTGTGTGCGGGCTAAACCC |
Downstream region at tRNA end position |
tccttagcat |
Secondary structure (Cloverleaf model) | >W131217986 Ser GGA a GCCA tccttagcat G - C G - C A - T G - C G - C G - C G - C T A T C A C C C A C G A G | | | | | G G G C C C G T G G G C G | | | T T C A G G G C G A G TGTGCGGGCTAAACCCCGCACC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |