Sequence ID | >W131230049 |
Genome ID | AUHH01000009 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Granulicoccus phenolivorans DSM 17626 [AUHH] |
Start position on genome | 92231 |
End posion on genome | 92146 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ccttctcggc |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCGCTCGCTTGGAAAGCGGGTTGGGTTAACGCCCTC |
Downstream region at tRNA end position |
atcgaacgcc |
Secondary structure (Cloverleaf model) | >W131230049 Ser GGA c GCgg atcgaacgcc G - C G - C A - T G - C G - C A - T T - A T A T T C C C C A T G A C | | | | | G G T C C G A G G G G C G | | | T T C T G G C C T A G TTGGGTTAACGCCCTC C - G T + G C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |