Sequence ID | >W131236229 |
Genome ID | AUMF01000017 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Tenacibaculum ovolyticum DSM 18103 [AUMF] |
Start position on genome | 1510 |
End posion on genome | 1438 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aataagttat |
tRNA gene sequence |
TGGCCTATGGTGTAATTGGTAACACACCGGTTTTTGGTACCGACATTCAAGGTTCGAGTC |
Downstream region at tRNA end position |
aatcattaca |
Secondary structure (Cloverleaf model) | >W131236229 Gln TTG t ACtt aatcattaca T - A G - C G - C C - G C - G T - A A - T T G T G T T C C A T A A G | | | | | G T T G T G C A A G G C G | | | | T T G A C A C T A A CATT C A C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |