Sequence ID | >W131196133 |
Genome ID | ASTC01000006 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Oscillibacter sp. 1-3 [ASTC] |
Start position on genome | 496366 |
End posion on genome | 496290 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggcgagttat |
tRNA gene sequence |
GGCGGCATAGCTCAGTTGGCTAGAGCATGCGGTTCATACCCGCAGTGTCCCCGGTTCAAA |
Downstream region at tRNA end position |
aatccatgga |
Secondary structure (Cloverleaf model) | >W131196133 Met CAT t ACCA aatccatgga G + T G - C C - G G - C G - C C - G A - T T A T G G A C C A T G A A | | | | A T C T C G C C C G G C G | | | | T T G G A G C C T A A GTGTC T - A G - C C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |