Sequence ID | >W1711462102 |
Genome ID | MJHM01000002 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium baratii [MJHM] |
Start position on genome | 75747 |
End posion on genome | 75822 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
accattttat |
tRNA gene sequence |
GGGCGCATAGCTCAGCTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCACAGGTTCGATC |
Downstream region at tRNA end position |
taaaatttaa |
Secondary structure (Cloverleaf model) | >W1711462102 Val TAC t ACCA taaaatttaa G - C G - C G - C C - G G + T C - G A - T C T T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |