Sequence ID | >W1711476237 |
Genome ID | MJVN01000023 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter jejuni [MJVN] |
Start position on genome | 2 |
End posion on genome | 77 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
nnnnnnnnna |
tRNA gene sequence |
GGTCGCTTAGCTCAGTTGGTAGAGCGCCACCCTTACAAGGTGGATGTCATAAGTTCGAGT |
Downstream region at tRNA end position |
ttttataaaa |
Secondary structure (Cloverleaf model) | >W1711476237 Val TAC a ACCA ttttataaaa G - C G - C T - A C - G G + T C - G T - A T G T T A T T C A T G A A | | | | | G T C T C G A T A A G C G | | | | T T G G A G C T A G ATGTC C - G C - G A - T C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |