| Sequence ID | >W1711476302 |
| Genome ID | MJVO01000050 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni [MJVO] |
| Start position on genome | 129 |
| End posion on genome | 205 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
tactttggat |
| tRNA gene sequence |
GCAGCGGTAGTTCAGCTGGTTAGAATGCCGCCCTGTCACGGCGGAGGTCGCGGGTTCGAG |
| Downstream region at tRNA end position |
tcttgtctcg |
| Secondary structure (Cloverleaf model) | >W1711476302 Asp GTC
t GCCA tcttgtctcg
G - C
C - G
A - T
G - C
C - G
G - C
G - C C G
T T G C C C A
C G A A + | | | | G
T C T T G G C G G G C
G | | | + T T
G G A A T
T T A G AGGTC
C - G
C - G
G - C
C - G
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |