Sequence ID | >W1711484316 |
Genome ID | MKCO01000423 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Poseidonibacter lekithochrous LFT 1.7 [MKCO] |
Start position on genome | 152 |
End posion on genome | 228 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaaataagat |
tRNA gene sequence |
GCTTCCATAGCTCAGCTGGATAGAGCAACGCCCTTCTAAGGCGTAGGTCGCACGTTCGAA |
Downstream region at tRNA end position |
ctnnnnnnnn |
Secondary structure (Cloverleaf model) | >W1711484316 Arg TCT t ACCA ctnnnnnnnn G + T C - G T - A T + G C - G C - G A - T T A T C G T G C A C G A A | | | | | G T C T C G G C A C G C G | | | | T T G G A G C A T A A AGGTC A - T C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |