| Sequence ID | >W1711486698 |
| Genome ID | MKEY01000019 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni [MKEY] |
| Start position on genome | 131501 |
| End posion on genome | 131427 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
aaatatttat |
| tRNA gene sequence |
TGGGGTATCGCCAAGCGGTAAGGCAACAGGTTTTGGTCCTGTCATTCAGGGGTTCGAATC |
| Downstream region at tRNA end position |
cttcttattt |
| Secondary structure (Cloverleaf model) | >W1711486698 Gln TTG
t TCCA cttcttattt
T - A
G - C
G - C
G - C
G - C
T - A
A - T T A
T T T C C C A
G A C | + | | | G
C A C C G A G G G G C
G | | | T T
G A G G C
T A A CATTC
A - T
C - G
A - T
G - C
G - C
T T
T G
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |