Sequence ID | >W1711487581 |
Genome ID | MKGD01000059 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Latilactobacillus curvatus [MKGD] |
Start position on genome | 14476 |
End posion on genome | 14403 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
taaatgacaT |
tRNA gene sequence |
GGCCCGTTGGTCAAGTGGTTAAGACACCGCCCTTTCACGGCGGTATCATGGGTTCAAATC |
Downstream region at tRNA end position |
ttttggaggt |
Secondary structure (Cloverleaf model) | >W1711487581 Glu TTC T ATtt ttttggaggt G - C G + T C - G C - G C - G G - C T - A T A T T G C C C A T G A G | + | | | A G A C T G A T G G G C G | | | T T T A G A C T A A TATC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |