Sequence ID | >W1711492265 |
Genome ID | MKKG01000011 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Gordonia sp. CNJ-863 [MKKG] |
Start position on genome | 182126 |
End posion on genome | 182050 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tcactccgaa |
tRNA gene sequence |
GCCCCCATAGCCCAAATGGCAGAGGCAGCCGACTTAAAATCGGCACAGTGTCGGTTCGAG |
Downstream region at tRNA end position |
ggttgtcgaa |
Secondary structure (Cloverleaf model) | >W1711492265 Leu TAA a ACCG ggttgtcgaa G - C C - G C - G C - G C - G C - G A - T T G T C A G C C A A A A A | | | | | G T C C C G G T C G G C G | | | T T G A G G C C A G A ACAGT G - C C - G C - G G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |