Sequence ID | >W1711501324 |
Genome ID | MKRM01000091 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Acidovorax sp. 65-7 [MKRM] |
Start position on genome | 19885 |
End posion on genome | 19809 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tatttcttac |
tRNA gene sequence |
CGCGCGATGGAGCAGCCTGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
aaacatagca |
Secondary structure (Cloverleaf model) | >W1711501324 Met CAT c ACCA aaacatagca C A G - C C - G G - C C - G G - C A - T T A T C T T C C A C G A G | + | | | A C C G A G G G A G G C T | | | | T T G G C T C G T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |