Sequence ID | >W1711503538 |
Genome ID | MKTR01000034 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Microbacterium sp. 67-17 [MKTR] |
Start position on genome | 346812 |
End posion on genome | 346902 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gctggacgac |
tRNA gene sequence |
GGTGACGTGTCCGAGCGGCCGAAGGTGCAACTCTCGAAAAGTTGTGTAGGGTAACCCCCT |
Downstream region at tRNA end position |
tttttctccc |
Secondary structure (Cloverleaf model) | >W1711503538 Ser CGA c GCCA tttttctccc G - C G - C T - A G - C A - T C - G G - C T A T C A C C C A C G A G | | | | | A G G C C T G T G G G C G | | T T C A G G T C G A G TGTAGGGTAACCCCCTACC C - G A - T A - T C - G T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |