Sequence ID | >W1711509603 |
Genome ID | MKZS01000001 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Moorena bouillonii PNG5-198 [MKZS] |
Start position on genome | 531034 |
End posion on genome | 530961 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
cagcagttaa |
tRNA gene sequence |
GGGCTTGTAGCTCAGTGGACTAGAGCACGTGGCTACGGACCACGGTGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
actaagctaa |
Secondary structure (Cloverleaf model) | >W1711509603 Arg ACG a Gttt actaagctaa G - C G - C G - C C - G T - A T T G - C T A T C T C C C A T G A A | + | | | G G C T C G G G G G G C G | | | | T T A G A G C C T A A GTGTC C - G G - C T - A G - C G - C C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |