Sequence ID | >W1711540092 |
Genome ID | MLZL01000011 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium animalis subsp. lactis [MLZL] |
Start position on genome | 141611 |
End posion on genome | 141685 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ggtctgttgc |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGTTAGAGCGCCACCTTTACACGGTGGATGTCAGGGGTTCGAG |
Downstream region at tRNA end position |
ttcttctccg |
Secondary structure (Cloverleaf model) | >W1711540092 Val TAC c ACgt ttcttctccg G - C G - C G - C C - G G - C A - T T - A T G T T T C C C A T G A A | + | | | G T C T C G A G G G G C G | | | | T T G G A G C T T A G ATGTC C - G C - G A - T C - G C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |