| Sequence ID | >W1711558361 |
| Genome ID | MMPB01000012 |
| Phylum/Class | Actinomycetota |
| Species | Mycobacterium tuberculosis [MMPB] |
| Start position on genome | 735462 |
| End posion on genome | 735389 |
| Amino Acid | Ala |
| Anticodon | GGC |
| Upstream region at tRNA start position |
atcacttcat |
| tRNA gene sequence |
GGGGCTATGGCGCAGCTGGTAGCGCACCACACTGGCAGTGTGGGGGTCAGGGGTTCGAGT |
| Downstream region at tRNA end position |
aggatcccgg |
| Secondary structure (Cloverleaf model) | >W1711558361 Ala GGC
t ACtc aggatcccgg
G - C
G - C
G + T
G - C
C - G
T - A
A - T T G
T T C C C C A
C G A G | | | | | G
T C G C G A G G G G C
G | | | | T T
G G C G C
T A A GGGTC
C - G
C - G
A - T
C - G
A - T
C G
T A
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |