Sequence ID | >W1711572428 |
Genome ID | MNBW01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Nioella nitratireducens [MNBW] |
Start position on genome | 1622 |
End posion on genome | 1533 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ggaccgaccc |
tRNA gene sequence |
GGAGGAGTGGCAGAGTGGTCGAATGCACCGGTCTTGAAAACCGGCGTGCGTGAAAGCGTA |
Downstream region at tRNA end position |
accacataac |
Secondary structure (Cloverleaf model) | >W1711572428 Ser TGA c GCCA accacataac G - C G - C A - T G - C G - C A - T G - C T A T C A C C C A T G A G | | | | | G G G A C G G T G G G C G | | | T T T A T G C C G A A CGTGCGTGAAAGCGTACC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |