Sequence ID | >W1711573913 |
Genome ID | MNEC01000119 |
Search identical group | |
Phylum/Class | Acidobacteriota |
Species | Acidobacteriales bacterium 13_2_20CM_2_55_5 [MNEC] |
Start position on genome | 9507 |
End posion on genome | 9583 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tgaaatgcat |
tRNA gene sequence |
GGCGGCGTAGCTCAGGTGGCTAGAGCGACGGTCTCATAATCCGTAGGTCGTTGGTTCGAG |
Downstream region at tRNA end position |
attttaaaaa |
Secondary structure (Cloverleaf model) | >W1711573913 Met CAT t ACCA attttaaaaa G - C G - C C - G G - C G - C C - G G - C T G T C A A C C A G G A A | | | | | G T C T C G G T T G G C G | | | | T T G G A G C C T A G AGGTC A - T C - G G - C G - C T T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |