Sequence ID | >W1711577290 |
Genome ID | MNPQ01000028 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces albidoflavus [MNPQ] |
Start position on genome | 76548 |
End posion on genome | 76475 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
catctgcaag |
tRNA gene sequence |
GCCCCCGTTGTGTAGCGGCCTAGCACGCCGCCCTCTCAAGGCGGTAGCGCCGGTTCGAAT |
Downstream region at tRNA end position |
agaagaaggg |
Secondary structure (Cloverleaf model) | >W1711577290 Glu CTC g ACag agaagaaggg G + T C - G C - G C - G C - G C - G G - C T A T T G G C C A C G A T + | | | | G G T G T G G C C G G C G + | | | T T C G C A C C T A G TAGC C - G C - G G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |