Sequence ID | >W1711583427 |
Genome ID | MNXE01000043 |
Search identical group | |
Phylum/Class | Hydrogenophilia |
Species | Hydrogenophilaceae bacterium CG1_02_62_390 [MNXE] |
Start position on genome | 14860 |
End posion on genome | 14785 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ggccccctct |
tRNA gene sequence |
GGGGGCATAGCTCAGCTGGGAGAGCGTCTGGTTCGCAATCAGAAGGTCGGGAGTTCGATC |
Downstream region at tRNA end position |
ccacactaaa |
Secondary structure (Cloverleaf model) | >W1711583427 Ala CGC t ACCA ccacactaaa G - C G - C G + T G - C G + T C - G A - T C T T C C C T C A C G A A | | | | | G T C T C G G G G A G C G | | | | T T G G A G C G A G AGGTC T - A C - G T - A G - C G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |