Sequence ID | >W1711584198 |
Genome ID | MNYF01000208 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Deltaproteobacteria bacterium CG2_30_43_15 [MNYF] |
Start position on genome | 363 |
End posion on genome | 438 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
catatagtga |
tRNA gene sequence |
GCGGGCATAGCTCAGTTGGTAGAGTACAAGCTTCCCAAGCTTGGTGTCGCGGGTTCGAAT |
Downstream region at tRNA end position |
cttttaatca |
Secondary structure (Cloverleaf model) | >W1711584198 Gly CCC a TCCA cttttaatca G - C C - G G - C G - C G - C C - G A - T T A T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T A A GTGTC C - G A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |