Sequence ID | >W1711585333 |
Genome ID | MNZP01000048 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Syntrophaceae bacterium CG2_30_49_12 [MNZP] |
Start position on genome | 5312 |
End posion on genome | 5386 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tcattttaaT |
tRNA gene sequence |
GGGCCGTTAGCTCAGATGGTAGAGCAGCGGACTTTTAATCCGTTGGTCGGGAGTTCGAGT |
Downstream region at tRNA end position |
tccgattcaa |
Secondary structure (Cloverleaf model) | >W1711585333 Lys TTT T ATtt tccgattcaa G - C G - C G - C C - G C - G G - C T - A T G T T C C T C A A G A A + | | | | G T C T C G G G G A G C G | | | | T T G G A G C T A A TGGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |