Sequence ID | >W1711585354 |
Genome ID | MNZP01000160 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Syntrophaceae bacterium CG2_30_49_12 [MNZP] |
Start position on genome | 636 |
End posion on genome | 562 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tgactaagga |
tRNA gene sequence |
TGGGGCGTCGTCAAGCGGTAAGACACAAGATTTTGGTTCTTGCATACGGAGGTTCGAATC |
Downstream region at tRNA end position |
gtcgtatgtt |
Secondary structure (Cloverleaf model) | >W1711585354 Gln TTG a GCCA gtcgtatgtt T - A G - C G - C G - C G - C C - G G - C T A T C C T C C A G A C | | | | | G C A C T G G G A G G C G | | | T T G A G A C T A A CATAC C - G A - T A - T G - C A - T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |