Sequence ID | >W1711585422 |
Genome ID | MNZR01000214 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Syntrophobacteraceae bacterium CG2_30_61_12 [MNZR] |
Start position on genome | 8307 |
End posion on genome | 8382 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
catttttttt |
tRNA gene sequence |
GGTCCCATCGTCTAGTGGCCCAGGACACCGGCCTCTCACGCCGGAGACACGGGTTCGAAC |
Downstream region at tRNA end position |
aggaaatcaa |
Secondary structure (Cloverleaf model) | >W1711585422 Glu CTC t ACCA aggaaatcaa G + T G - C T - A C - G C - G C - G A - T C A T T G C C C A T G A C | | | | | G G T C T G A C G G G C G + | | | T T C G G A C C C A A AGAC C - G C - G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |