Sequence ID | >W1711585818 |
Genome ID | MOAD01000001 |
Search identical group | |
Phylum/Class | Acidithiobacillia |
Species | Acidithiobacillus albertensis [MOAD] |
Start position on genome | 2408373 |
End posion on genome | 2408447 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aatgagttat |
tRNA gene sequence |
TGGGGCGTAGCCAAGCGGTAAGGCACCGGATTTTGATTCCGGCATTCCCAGGTTCGATCC |
Downstream region at tRNA end position |
attgtcctcg |
Secondary structure (Cloverleaf model) | >W1711585818 Gln TTG t GCCA attgtcctcg T - A G - C G - C G - C G - C C - G G - C C T T G G T C C A G A A | | | | | G C A C C G C C A G G C G | | | T T G A G G C T A A CATTC C - G C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |